Journal of Nature and Science (JNSCI), Vol.1, No.1, e34, 2015

Biological Sciences

 

Effectively organ-specific virus induced gene silencing in tomato plant

 

Tian Wang, Li Wei Wen, Hong Liang Zhu*

 

The College of Food Science and Nutritional Engineering, China Agricultural University, No. 17 Tsinghua East Road, Beijing 100083, China


Virus-induced gene silencing (VIGS) is a valuable tool for identification and characterization of genes function. To improve the efficiency of VIGS in different organ, we developed an organ-specific VIGS that could be applied to tomato (Solanum lycopersicum cv Micro Tom) leaves, flowers and fruits respectively. With phytoene desaturase (PDS) as a reporter gene, almost up to 100% of efficiency of VIGS was achieved in tomato leaves, flowers and fruits. The suppression of PDS gene in these organs was also up to 90% compared with control tomato plants. In addition, a few sucrose in infiltration buffer is important for VIGS in flowers and fruits, which could help the Agrobacterium culture attached to organ longer and largely increase the time of infection. In short, organ-specific VIGS would shed light on rapid characterization of key genes function in whole tomato growth and reproductive development. Journal of Nature and Science, 1(1):e34, 2015.

 

Solanum lycopersicum | virus-induced gene silencing | phytoene desaturase gene | tobacco rattle virus

 

Virus-induced gene silencing (VIGS) is a powerfully handy tool for identification of genes function (Senthil-Kumar and Mysore 2011), which is an easy, rapid, reliable and transformation-free method (Lange et al. 2013). Normally, partial sequence information of one gene is sufficient to silence itself. Recombinant virus vectors carried part of a gene is agro-infiltrated into a plant and induce the obvious phenotype only in a few weeks (2-4 weeks) (Lange et al. 2013). VIGS has been widely used for many plant species(Huang et al. 2012) such as Arabidopsis, tobacco, tomato, rice, maize, grape, apple and pear, and for validation of functional genes involved in plant development (Liu et al. 2010), virus infection(Caplan et al. 2008), disease resistance(Rowland et al. 2005), insect resistance(Mantelin et al. 2011), abiotic stress tolerance(George et al. 2010) and nutrient stress(Pacak et al. 2010). It is so difficult to characterize key metabolic and regulatory genes at late developmental stages by classical plant transformation method, whose loss-of-function mutants show lethality and severe growth arrest at early developmental stages(Burch-Smith et al. 2004). Many researches suggest VIGS is one of the most powerful tools for the analysis of key genes which mutations cause embryonic and seedling-lethality(Robertson 2004). However, Short duration of VIGS in plant is not good for validation the function of genes from seedlings to the terminal growth stage and reproductive development(Senthil-Kumar and Mysore 2011). Long-duration VIGS is likely to be potentially substitute for the need for mutants or stable RNA interference (RNAi) lines(Senthil-Kumar and Mysore 2011), but it depends on appropriate conditions. Moreover, low silencing efficiency in long-duration VIGS is another problem for study the gene function in whole plant development. Organ-specific VIGS may be possible to address above problems, which can induce the silencing of one gene in leaves, flowers and fruits respectively.

  Due to its consumption, today tomato absolutely occupies a economically important position in world vegetable production (FAOSTAT 2012; http://faostat.fao.org/). The tomato genome sequencing being recently finished, it becomes more convenient to find the sequence information of genes and more urgent to determine functions of many yet to be characterized genes.. VIGS is increasingly being used in tomato to elucidate gene function(Sahu et al. 2012). Various key regulating factors involved in ethylene synthesis and leaf abscission have been functional exploration as well as fruit color development(Sahu et al. 2012; Fantini et al. 2013), such as LeHB-1, SlEBF1/2, LeEIN2, LeRIN, SlTAPG and SlMYB12. However, VIGS could not completely repress the expression of target gene, and phenotype may not at all be observed in the silenced plant. In addition, the level of silencing by VIGS may also vary between plants and experiments. Compared to S. lycopersicum, S. pennellii showed more efficient gene silencing and the phenotype of silencing was clearly showed on stems, flowers and fruits(Senthil-Kumar and Mysore 2011). It will be difficult for the analysis of results when the VIGS does not produce a visible phenotype. Normally, a marker gene could be use for visualization of the silenced regions, such as phytoene desaturase (PDS)( Liu et al. 2002), green fluorescence protein (GFP)( Quadrana et al. 2011) and Antirrhinum majus Delila and Rosea1 expressing transcription factors(Del/Ros1)( Orzaez et al. 2009). PDS catalyzes a key step in the carotenoid biosynthesis pathway, and is important for chlorophyll. Inhibition of PDS expression results in the decrease of carotenoids and the destruction of chlorophyll(Kumagai et al. 1995), which induces that leaves turn to white( Liu et al. 2002). Here we show organ-specific VIGS in tomato plants using PDS as marker gene, almost completely repressing PDS in leaves, flowers and fruits. It would shed light on rapid characterization of key genes function in whole tomato growth and reproductive development, especially for the genes whose mutation is lethal for plant development.

 

MATERIALS AND METHODS

Plant Material and Growth Conditions

The seeds of tomato cultivar MicroTom were planted in commercial tomato-cultivated soil. All plants were grown in the greenhouse at 22°C with 75% relative humidity under a 16 h light/8 h dark cycle.

 

Constructs and VIGS Treatments

For the VIGS of tomato Micro-Tom, the pTRV1 and pTRV2 vectors were adopted. The construction of pTRV2-PDS was described before(Fu et al. 2005). Agrobacterium strain GV3101 containing pTRV1, pTRV2 and pTRV2-PDS vectors were grown at 28 °C in LB medium (pH 5.6) containing 10 mM Morpholineethanesulfonic acid and 20 μM acetosyringone with kanamycin, gentamycin and rifampicin antibiotics. After shaking for 16 h, cultures were harvested and resuspended in infiltration buffer (10 mM MgCl2, 200 μM acetosyringone) to a final O.D.600 of 1.8. For injection of flower and fruit, the infiltration buffer contained 5% sucrose. Resuspensions of pTRV1 and pTRV2 or pTRV2-PDS were mixed at a ratio of 1:1 and left at room temperature for 3 h. Agrobacterium was infiltrated into the cotyledon of seedling, the shoot of seedling and the carpopodium of fruit respectively with a 1 mL syringe. Tomato infiltrated with pTRV1 and pTRV2 was used as control. Each inoculation was carried out three times and each time six different organs were infiltrated. When VIGS phenotype was visible, tomato leaves, flowers and fruits were collected and stored in -80℃.

 

TABLE 1  List of Primers Used in This Study

Primer Name

Sequence (5'-3')

TRV RT primer

GGGCGTAATAACGCTTACGTAGGC

CP For

CTGACTTGATGGACGATTCTT

CP Rev

TGTTCGCCTTGGTAGTAGTA

TRV2-PDS For

GTCGACGCTTTACCCGCTCCTT

TRV2-PDS Rev

ATCGATTGCACTACCGTCACTC

PDS For for qRT-PCR

AGTTAGTCGGAGTACCTGTG

PDS Rev for qRT-PCR

AGTGAGCTTCTGCTGAAGAG

Actin For for qRT-PCR

cagcagatgtggatctcaaa

Actin Rev for qRT-PCR

ctgtggacaatggaaggac

For for forward; Rev for reverse.

 

 

Gene Expression Analysis

Total RNA was isolated from TRV control and TRV-PDS samples using DeTRNa reagent (EarthOx, CA, USA). The RNA concentration and purity were measured using a NAS-99 spectrophotometer (ATCGene, NJ, USA). The RNA integrity was checked by agarose gel electrophoresis. 2 μg total RNA was used for the first-strand cDNA synthesis using a TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix kit (Trans, Beijing, China) with oligo(dT) primer or TRV RT primer. RT-PCR was performed using EasyTaq PCR SuperMix (Trans, Beijing, China) with PCR system T-100 (Bio-rad, CA, USA). RT-PCR conditions for CP and PDS were as follows: 94 °C for 10 min, followed by 24 cycles of 94 °C for 30 s, 55 °C for 30 s and 72°C for 30 s. The quantitative real-time PCR (qRT-PCR) was performed using SYBR Green PCR Master Mix with a BIO-RAD real-time PCR System CFX96 (Bio-rad, CA, USA). PDS primers that anneal outside the region targeted for silencing were used to ensure that only the endogenous gene would be used. qRT-PCR conditions were as follows: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s. Fluorescence changes of SYBR Green were monitored automatically in each cycle, and the threshold cycle (Ct) over the background was calculated for each reaction. Samples were normalized using Actin and the relative expression levels were measured using the 2−ΔΔCt analysis method. Oligonucleotide primers used in this study are listed in Table 1. All RT-PCR data presented are representative of three independent experiments.

 

Fig 1. Efficient PDS silencing in tomato leaves.

(a) and (b), the sites of injection on cotyledon of tomato infiltrated with TVR control and TRV-PDS respectively. Red arrows indicated the sites of injection. (c), TRV control tomato plant. (d), PDS silenced tomato plant showing photo bleaching phenotype. (e) and (f), close up from control tomato leaves and PDS silenced leaves respectively. (g), RT-PCR detection of recombinant TRV RNA in upper uninjected leaves. RNA samples were extracted from TRV-PDS and TRV control tomato plant, and RT-PCR was performed with TRV2-PDS and CP primers. (h), qRT-PCR analysis of PDS transcript in TRV control and TRV-PDS tomato plants. Actin expression values were used for internal reference. The relative level of PDS transcripts was normalized to that in TRV control plants where the amount was arbitrarily assigned a value of 1. Error bars indicate ±SD of three biological replicates, each measured in triplicate. Asterisks indicate significant difference as determined by Student’s t-test (P ≤ 0.01).

 

RESULTS AND DISCUSSION

Efficient VIGS of PDS Gene Induced Bleach Phenotype in Tomato Leaves

PDS silencing by VIGS inhibits carotenoid biosynthesis, causing the plants to exhibit a photo-bleached phenotype. Compared to 100% efficiency in tobacco, the Agrobacterium infiltration method of infecting TRV-PDS resulted in the PDS silencing phenotype in only five out of 10 tomato plants (50% efficiency) ( Liu et al. 2002). In addition, another spray method improved the efficiency of silencing in tomato to 90%( Liu et al. 2002). However, the spray method needs more instrument such as airbrush and air compressor, as well as good hand to get representative results. Considering compact architecture of the young tomato leaves, we wondered whether tomato cotyledon could be a good target for Agrobacterium infiltration. In order to do so, we infiltrated Agrobacterium cultures containing pTRV2-PDS and pTRV1 into the cotyledon of one-week tomato seedling (Fig. 1a and 1b). After two weeks, compared with TRV control plants (Fig. 1c), all the 20 seedling infiltrated with TRV-PDS exhibited the photo-bleached phenotype (Fig. 1d), the efficiency of silencing is almost 100%. Young leaves of TRV control plants kept green (Fig. 1e), whereas the young true leaves of tomato totally turned to white (Fig. 1f), which phenotypes were exactly the same as those observed in tomato by VIGS( Liu et al. 2002). To further determine whether photo-bleached phenotype was induced by the silencing of PDS, we firstly detect the TRV-PDS virus of young leaves in RT-PCR assay, a result clearly indicating recombinant TRV can efficiently replicate and spread systemically in tomato plants (Fig. 1g). Secondly, qRT-PCR analysis suggested PDS was silenced by 87% in white leaves compared with leaves infiltrated with TRV alone (Fig. 1h). Together these results indicated infiltration through cotyledon is more efficient in the induction of silencing in tomato leaves, which suggested that other important genes in leaves could be targeted for silencing in a similar manner.

 

Fig 2. Induced silencing of PDS gene by VIGS in tomato flowers.

(a) and (b), the sites of injection on shoot of tomato infiltrated with TVR control and TRV-PDS respectively. Red arrows indicated the sites of injection. (c), TRV control tomato flowers. (d), PDS silenced tomato flower petals showing photo bleaching phenotype. (e) and (f), close up from control tomato flowers and PDS silenced flowers respectively. (g), RT-PCR detection of recombinant TRV RNA in upper uninjected flowers, which were conducted as in Fig 1g. (h), qRT-PCR analysis of PDS transcript in TRV control and TRV-PDS tomato flowers, which were conducted as in Fig 1h. Asterisks indicate significant difference as determined by Student’s t-test (P ≤ 0.01).

 

Figure 3. PDS gene silencing in whole tomato fruit.

(a) and (b), the sites of injection on carpopodium of tomato fruit infiltrated with TVR control and TRV-PDS respectively. Red arrows indicated the sites of injection. (c), TRV control tomato fruit. (d), PDS silenced tomato fruit showing yellow color. (e) and (f), close up from control tomato fruit and PDS silenced fruit respectively. (g), RT-PCR detection of recombinant TRV RNA in upper uninjected fruits, which were conducted as in Fig 1g. (h), qRT-PCR analysis of PDS transcript in TRV control and TRV-PDS tomato fruits, which were conducted as in Fig 1h. Asterisks indicate significant difference as determined by Student’s t-test (P ≤ 0.01).

 

Directly Induced Silencing of PDS Gene by VIGS in Tomato Flowers

Normallyplant development can be divided into vegetative and reproductive growth phases. Flowering is critical for the reproduction of angiosperms(Luo et al. 2013). VIGS has been used to identify the function of genes involved in flower development and senescence(Spitzer-Rimon et al. 2013; Chang et al. 2014; Jiang et al. 2014). However, the efficiency of VIGS in flowers is not good as in leaves. In order to improve the efficiency of VIGS in flower, we infiltrated into shoot (Fig. 2a and 2b) with Agrobacterium culture containing sucrose, which could help the culture attached the shoot longer and not evaporated easily. After three weeks post infiltration, all the petals of flowers turn to white (Fig. 2d), whereas TRV control flowers kept yellow (Fig. 2c), which indicated the efficiency of our VIGS in flower is almost 100%. RT-PCR and qRT-PCR analysis suggested recombinant virus could rapid spread from shoot to flower and silence PDS gene by 75% in tomato flowers (Fig. 2g and 2h). These results clearly showed adding sucrose in infiltration buffer is good for VIGS, especially for the infiltration that it is not easy to inject Agrobacterium culture into the inside of plants.

 

PDS gene was Silenced in Whole Tomato Fruit

Tomato fruit is a model for fleshy fruit development. VIGS is one of widely used tools to identify gene function in tomato fruit development and ripening(Fu et al. 2005; Fernandez-Moreno et al. 2013). However, tomato plants inoculated at the leaves show silenced symptoms in about half of their fruit(Fu et al. 2006). When injecting Agrobacterium culture into the carpopodium of fruit, most silenced sectors of tomato fruit represented only 30% to 70% of the fruit surface(Fu et al. 2005). Although the higher percentage of silenced fruit reached up to 90% when tomatoes are agroinjected directly in the fruit(Orzaez et al. 2006), it is not good that Agrobacterium culture which is inside of fruit would induce artificial phenotype. To improve the distribution of silenced sectors of tomato fruit by VIGS, we also added sucrose into Agrobacterium culture and injected through the carpopodium of mature green stage fruit (Fig. 3a and 3b). Fortunately, after two or three weeks whole tomato fruit injected with TRV-PDS turned from green to yellow, not red (Fig. 3c and 3d). The silenced sectors of tomato fruit represented 90% to 100% of the fruit surface. Furthermore, RT-PCR and qRT-PCR analysis suggested recombinant virus could rapidly spread from carpopodium to fruit and silence PDS gene by 95% (Fig. 3g and 3h). All these results convincingly indicated our VIGS in tomato fruit above is another potential and alternative tool to characterize the function of genes involved fruit development and ripening, which is more convenient, efficient and precise. 

 

ACKNOWLEDGMENTS

We would like to thank Dr S.P. Dinesh-Kumar (Yale University) for offering pTRV1 and pTRV2 vector. This work was supported by Chinese Universities Scientific Fund (2014RC006).



Burch-Smith T M, Anderson J C, Martin G B and Dinesh-Kumar S P. 2004. Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal 39(5):734-46

Caplan J L, Mamillapalli P, Burch-Smith T M, Czymmek K and Dinesh-Kumar S P. 2008. Chloroplastic Protein NRIP1 Mediates Innate Immune Receptor Recognition of a Viral Effector. Cell 132(3):449-62

Chang X, Donnelly L, Sun D, Rao J, Reid M S and Jiang C. 2014. A Petunia Homeodomain-Leucine Zipper Protein, PhHD-Zip, Plays an Important Role in Flower Senescence. PLoS One 9(2):e88320

Fantini E, Falcone G, Frusciante S, Giliberto L and Giuliano G. 2013. Dissection of Tomato Lycopene Biosynthesis through Virus-Induced Gene Silencing. Plant Physiolog 163(2):986-98

Fernandez-Moreno J P, Orzaez D and Granell A. 2013. VIGS: a tool to study fruit development in Solanum lycopersicum. Virus-Induced Gene Silencing Methods and Protocols, pp183-96. Annette Becker. Humana Press, Gießen, Germany

Fu D Q, Zhu B Z, Zhu H L, Zhang H X, Xie Y H, Jiang W B, Zhao X D and Luo K B. 2006. Enhancement of virus-induced gene silencing in tomato by low temperature and low  humidity. Molecules and Cells 21(1):153-60

Fu D, Zhu B, Zhu H, Jiang W and Luo Y. 2005. Virus-induced gene silencing in tomato fruit. The Plant Journal 43(2):299-308

George G M, van der Merwe M J, Nunes-Nesi A, Bauer R, Fernie A R, Kossmann J and Lloyd J R. 2010. Virus-Induced Gene Silencing of Plastidial Soluble Inorganic Pyrophosphatase Impairs Essential Leaf Anabolic Pathways and Reduces Drought Stress Tolerance in Nicotiana benthamiana. Plant Physiology 154(1):55-66

Huang C, Qian Y, Li Z and Zhou X. 2012. Virus-induced gene silencing and its application in plant functional genomics. Science China Life Sciences 55(2):99-108

Jiang X, Zhang C, Lü P, Jiang G, Liu X, Dai F and Gao J. 2014. RhNAC3, a stress-associated NAC transcription factor, has a role in dehydration tolerance through regulating osmotic stress-related genes in rose petals. Plant Biotechnology Journal 12(1):38-48

Kumagai M H, Donson J, Della-Cioppa G, Harvey D, Hanley K and Grill L K. 1995. Cytoplasmic inhibition of carotenoid biosynthesis with virus-derived RNA. Proceedings of the National Academy of Sciences 92(5):1679-83

Lange M, Yellina A L, Orashakova S and Becker A. 2013. Virus-induced gene silencing (VIGS) in plants: an overview of target species and the virus-derived vector systems. Virus-Induced Gene Silencing Methods and Protocols, pp1-4. Annette Becker. Humana Press, Gießen, Germany

Liu B, Watanabe S, Uchiyama T, Kong F, Kanazawa A, Xia Z, Nagamatsu A, Arai M, Yamada T, Kitamura K, Masuta C, Harada K and Abe J. 2010. The Soybean Stem Growth Habit Gene Dt1 Is an Ortholog of Arabidopsis TERMINAL FLOWER1. Plant Physiology 153(1):198-210

Luo Y, Guo Z and Li L. 2013. Evolutionary conservation of microRNA regulatory programs in plant flower development. Developmental Biology 380(2):133-44

Mantelin S, Peng H, Li B, Atamian H S, Takken F L W and Kaloshian I. 2011. The receptor-like kinase SlSERK1 is required for Mi-1-mediated resistance to potato aphids in tomato. The Plant Journal 67(3):459-71

Orzaez D. 2005. Agroinjection of Tomato Fruits. A Tool for Rapid Functional Analysis of Transgenes Directly in Fruit. Plant Physiology 140(1):3-11

Orzaez D, Medina A, Torre S, Fernandez-Moreno J P, Rambla J L, Fernandez-del-Carmen A, Butelli E, Martin C and Granell A. 2009. A Visual Reporter System for Virus-Induced Gene Silencing in Tomato Fruit Based on Anthocyanin Accumulation. Plant Physiology 150(3):1122-34

Pacak A, Geisler K, Jørgensen B, Barciszewska-Pacak M, Nilsson L, Nielsen T, Johansen E, Grønlund M, Jakobsen I and Albrechtsen M. 2010. Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat. Plant Methods 6(1):26

Quadrana L, Rodriguez M C, Lopez M, Bermudez L, Nunes-Nesi A, Fernie A R, Descalzo A, Asis R, Rossi M, Asurmendi S and Carrari F. 2011. Coupling Virus-Induced Gene Silencing to Exogenous Green Fluorescence Protein Expression Provides a Highly Efficient System for Functional Genomics in Arabidopsis and across All Stages of Tomato Fruit Development. Plant Physiology 156(3):1278-91

Robertson D. 2004. VIGS VECTORS FOR GENE SILENCING: Many Targets, Many Tools. Annual Review of Plant Biology 55(1):495-519

Romero I, Tikunov Y and Bovy A. 2011. Virus-induced gene silencing in detached tomatoes and biochemical effects of phytoene desaturase gene silencing. Journal of Plant Physiology 168(10):1129-35

Rowland O. 2005. Functional Analysis of Avr9/Cf-9 Rapidly Elicited Genes Identifies a Protein Kinase, ACIK1, That Is Essential for Full Cf-9-Dependent Disease Resistance in Tomato. The Plant Cell Online 17(1):295-310

Sahu P P, Puranik S, Khan M and Prasad M. 2012. Recent advances in tomato functional genomics: utilization of VIGS. Protoplasma 249(4):1017-27

Senthil-Kumar M and Mysore K S. 2011. New dimensions for VIGS in plant functional genomics. Trends in Plant Science 16(12):656-65

Senthil-Kumar M and Mysore K S. 2011. Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnology Journal 9(7):797-806

Spitzer-Rimon B, Cna'Ani A and Vainstein A. 2013. Virus-aided gene expression and silencing using TRV for functional analysis of floral scent-related genes.c Virus-Induced Gene Silencing Methods and Protocols, pp139-48. Annette Becker. Humana Press, Gießen, Germany


 

__________

Conflict of interest: No conflicts declared.

*Correspondence author: Professor Hong Liang Zhu, Ph.D., The College of Food Science and Nutritional Engineering, China Agricultural University, No. 17 Tsinghua East Road, Beijing 100083, China. Email: hlzhu@cau.edu.cn

© 2015 by the Journal of Nature and Science (www.jnsci.org).